rs869431 chr15:88834478 C>T
- Sequence
ccctcatccccaaatccatccagc[C/T]ccagccggcggtgactgagccaag
- ASB in cell types
- SK-N-SH (neuroblastoma) GM02255 (Lymphoblastoid Cell Lines) A549 (lung carcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 2.15 | -0.94 | 1.21 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 1.02 | -0.80 | 1.00 | |||
| A549 (lung carcinoma) | 0.81 | 0.92 | 1.01 | |||
| T47D (invasive ductal carcinoma) | 0.17 | 1.03 | 2.00 | |||
| LUHMES (lund human mesencephalic cells) | 2.72 | -1.06 | 1.00 |
Items per page:
1 – 5 of 9