rs872589 chr13:110363281 C>T
- Sequence
ttctggaaggttgcgattgacaag[C/T]tcgctcaagtaagcagtggctgag
- ASB in cell types
- gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastroesophageal sphincter | 2.10 | -0.84 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, barnes akathisia rating scale, bipolar disorder, body mass index (bmi), ldl cholesterol, major depressive disorder, serum creatinine, total cholesterol, triglycerides, type 2 diabetes, combined control dataset, waist hip ratio