rs872949 chr4:70705485 C>T
- Sequence
cccggtgaggaggcagcgggacga[C/T]cgcggttcgggcgccggattctac
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) primary B-CLL cells
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 2.48 | -0.21 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1