rs874451 chr4:112448569 C>T
- Sequence
tttgcagattaaaatgatacatgg[C/T]gactcacgtgttactaggaggatt
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- RFX5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX5_HUMAN | -3.97 | 4.02 | 1.00 | -1.31 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
