rs874712 chr15:74314916 A>G
- Sequence
aggctgcagcagaagcccacagcc[A/G]ggcagggcccagagaagtctgaca
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PATZ1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PATZ1_HUMAN | 2.19 | -1.85 | 1.00 | 1.94 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
