rs876083 chr8:120089294 C>T
- Sequence
ccattaaagctcttatctagttac[C/T]cctgtctctcgtaggataggttgt
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) 22RV1 (prostate carcinoma) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 4.53 | -4.67 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 2.02 | 0.24 | 1.50 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -1.70 | 2.10 | 1.00 |
Items per page:
1 – 3 of 3