rs877809 chr9:74743052 C>T
- Sequence
tcatcttctttttccagagagagc[C/T]gaagaccgattttaattagaagcg
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) GM18486 (Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | -0.09 | 1.13 | 2.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.07 | -0.51 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -2.30 | 1.11 | 1.33 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.42 | -0.85 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.63 | 1.03 | 1.00 |
Items per page:
1 – 5 of 5