rs879207 chr17:3563302 A>G
- Sequence
taggagacttaaagggagatgcac[A/G]tggagcaccttcataaacactccc
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -2.02 | 2.17 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, mitral annular calcium, serum creatinine, transmission distortion
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid