rs880034 chr8:118621022 T>G
- Sequence
ggaagtttgtgttccaaggtaaga[T/G]aacctgaaatgaaaaactcaggat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HEK293 (embryonic kidney)
- ASB for transcription factors
- NR2C1_HUMAN ZN335_HUMAN ZBT20_HUMAN ZBT40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | 4.32 | n/a | 1.00 | 1.00 | Weak Discordant | |||
| ZN335_HUMAN | -2.55 | 2.41 | 1.33 | n/a | No Hit | |||
| ZBT20_HUMAN | n/a | 2.30 | 1.00 | n/a | No Hit | |||
| ZBT40_HUMAN | 2.35 | -1.88 | 1.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood