rs880812 chr11:117583442 C>G
- Sequence
gacctcatctcgctccgcaagaat[C/G]ccctgcccatccaaatctgaacgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- PAX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PAX2_HUMAN | -4.72 | 2.23 | 2.00 | 2.45 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
