rs881290 chr12:124391587 C>T
- Sequence
cctgcgtgtcttgtcaggacttcc[C/T]gaactcctgccatcctgaaatcct
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 3.34 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol, obesity with early age of onset (age >2), prop taste detection threshold