rs881382 chr4:57051180 G>T
- Sequence
gcactatggccaagatggggaagg[G/T]gatgaaacaagtggaagcttcctg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.63 | -0.39 | 2.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.40 | 1.30 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), exudative age-related macular degeneration, hdl cholesterol, height