rs881564 chr17:76132763 G>A
- Sequence
gggaccagcccactgccccctgcc[G/A]ggagcgcacctacacctatttacc
- ASB in cell types
- primary endometrium cancer
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary endometrium cancer | n/a | 2.55 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), hip bone mineral density (bmd), late onset alzheimers disease, sporadic creutzfeldt-jakob disease, urinary albumin-to-creatinine ratio