rs883669 chr15:77617753 C>T
- Sequence
ttctgggataggagctctggtctg[C/T]ccacaaaaccacacacttgcaaat
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines) T47D (invasive ductal carcinoma) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 2.73 | -2.47 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -1.35 | 1.66 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 0.09 | 0.86 | 2.00 | |||
| HeLa (cervical adenocarcinoma) | 0.87 | -0.01 | 1.40 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, microalbuminuria, obesity with early age of onset (age >2), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid