rs884618 chr1:154628681 A>G
- Sequence
attttcactgctacataaaaatcc[A/G]ttatgtaccataatttatccattc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.45 | 0.95 | 1.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, chronic kidney disease, hdl cholesterol, monocyte count, salmonella-induced pyroptosis, serum creatinine, soluble il6r (sil6r), triglycerides, years of education
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Liver, Lung, Whole_Blood