rs884672 chr10:104582801 T>C
- Sequence
gggcagacccgtcttgagcgattg[T/C]aggtgctggctacaaaccactctc
- ASB in cell types
- keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | n/a | 3.33 | 1.50 | 4.46 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, bipolar disorder, combined control dataset, birth weight, lp-pla2 activity, major depressive disorder, obesity with early age of onset (age >2)