rs885004 chr9:84294635 G>A
- Sequence
agttagcagagtaacctaagttga[G/A]ataaattgtgagcaacctcagagc
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.50 | -1.52 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.86 | -0.96 | 1.00 |
Items per page:
1 – 2 of 2