rs885970 chr22:17558731 T>C
- Sequence
gcttcattcagccaggcgcggtgg[T/C]tcacgtctgtaatcccagcacttt
- ASB in cell types
- foreskin keratinocyte COLO-829 (melanoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.66 | n/a | 2.33 | |||
| COLO-829 (melanoma) | 2.36 | -2.38 | 1.00 |
Items per page:
1 – 2 of 2