rs886424 chr6:30814225 C>T

Sequence
aactccaatgtcacctgctcctca[C/T]ctgtacccagtggacttttttggc
ASB in cell types
GM12878 (female B-cells lymphoblastoid cell line)
ASB for transcription factors
FOXK2_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (C) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
FOXK2_HUMAN 2.82 n/a 1.7·10-31.00 1.00 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI bipolar disorder and schizophrenia type 1 diabetes and autoimmune thyroid diseases
GRASP advanced age-related macular degeneration advanced age-related macular degeneration (geographic atrophy) alopecia areata arthritis including non-rheumatoid asthma bipolar disorder birth weight comorbid depressive syndrome and alcohol dependence coronary artery disease (cad) hdl cholesterol height hiv-1 control (viral load at set point) hiv-1 control (viral load) idiopathic membranous nephropathy infant head circumference late onset alzheimers disease ldl cholesterol longstanding arthritis lung cancer lung function, forced expiratory volume in 1 second (fev1) maternal transmission distortion myasthenia gravis parkinsons disease schizophrenia schizophrenia and bipolar disorder combined serum creatinine total cholesterol transmission distortion triglycerides type 1 diabetes waist hip ratio
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Adrenal_Gland Artery_Aorta Artery_Coronary Artery_Tibial Brain_Anterior_cingulate_cortex_BA24 Brain_Caudate_basal_ganglia Brain_Cerebellar_Hemisphere Brain_Cerebellum Brain_Cortex Brain_Frontal_Cortex_BA9 Brain_Hypothalamus Brain_Nucleus_accumbens_basal_ganglia Brain_Putamen_basal_ganglia Breast_Mammary_Tissue Cells_Cultured_fibroblasts Cells_EBV-transformed_lymphocytes Colon_Sigmoid Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Heart_Left_Ventricle Liver Lung Muscle_Skeletal Nerve_Tibial Ovary Pancreas Pituitary Prostate Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Small_Intestine_Terminal_Ileum Spleen Stomach Testis Thyroid Vagina Whole_Blood

Download