rs886427 chr16:2973604 A>G
- Sequence
tctgccctgagcgtgtggtttcct[A/G]attacagcctctcactcaagacac
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.00 | 1.27 | 1.60 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, bipolar disorder, prop taste detection threshold, triglycerides change with statins, waist hip ratio
PheWAS acquired deformities of finger, allergic rhinitis, allergies, other, anal and rectal polyp, anemia of chronic disease, arthropathy associated with neurological disorders, back & neck sprains, back pain, biliary cirrhosis, bladder neck obstruction, bundle branch block, bursitis, cachexia, carcinoma in situ of skin, cardiac arrhythmia nos, cardiac dysrhythmias, cellulitis and abscess of face, chronic airway obstruction, concussion, conductive hearing loss, corneal edema, decreased libido, dermatosis nos, diaphragmatic hernia, diseases of the tongue, disturbance of skin sensation, diverticulum of esophagus, acquired, essential tremor, fractur of unspecified part of femur, fracture of foot, gestational diabetes, glossitis, gouty arthropathy, h. pylori, hypothyroidism, infection/inflammation of internal prosthetic device, implant or graft, internal derangement of knee, intervertebral disc disorder with myelopathy, intracranial hemorrhage, lyme disease, magnesium metabolism disorder, malaise and fatigue, malignant neoplasm of kidney and other urinary organs, malignant neoplasm of renal pelvis, mastodynia, mechanical complications of cardiac/vascular device, implant, and graft, nephrotic syndrome without mention of glomerulonephritis, noninflammatory disorders of ovary, fallopian tube, & broad ligament, other and unspecified disc disorder, other conditions of the mother complicating pregnancy, other disorders of peritoneum, other hypertensive complications, other nonmalignant breast conditions, otitis externa, pelvic peritoneal adhesions, female (postoperative) (postinfection), pruritus and related conditions, psychogenic and somatoform disorders, rash and other nonspecific skin eruption, renal failure nos, respiratory insufficiency, salicylates causing adverse effects in therapeutic use, secondary malignancy of brain/spine, secondary malignancy of lung, secondary thrombocytopenia, spasm of muscle, spirochetal infection, spondylosis and allied disorders, spondylosis without myelopathy, subdural hemorrhage, symptoms affecting skin, testicular dysfunction, type 2 diabetic nephropathy, vascular insufficiency of intestine
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood