rs886926 chr17:57740052 C>T
- Sequence
ccttctcacctctactctggaaga[C/T]ttgccacatctgctgcatgagcca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma) stomach GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.16 | 0.82 | 1.70 | |||
| A549 (lung carcinoma) | 0.19 | 1.09 | 2.96 | |||
| stomach | 2.27 | -2.27 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -0.69 | 1.06 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP birth weight, cystatin c in serum, lp-pla2 activity, prop taste detection threshold, sporadic creutzfeldt-jakob disease