rs888197 chr12:12475285 T>C
- Sequence
taaggcttcaaaagaggacccaca[T/C]tgtagctgataaaactcaagccag
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) primary human Th1 T cells GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -2.96 | 2.85 | 1.00 | |||
| primary human Th1 T cells | 0.57 | 1.60 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.26 | -0.93 | 1.00 |
Items per page:
1 – 3 of 3