rs888817 chr5:80961979 G>A
- Sequence
tgaaaaaggctgattgtttttgct[G/A]ttgcgtaaaaatattcgcagctga
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | -0.77 | 1.72 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, diastolic blood pressure (dbp), longstanding arthritis, partial epilepsy, rheumatoid arthritis, serum creatinine, spine bone mineral density (bmd), systolic blood pressure (sbp), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Esophagus_Muscularis, Nerve_Tibial, Testis, Thyroid