rs889056 chr5:157612729 C>T
- Sequence
tggcaagtgagagtgaatctggat[C/T]cgtcagttctccggacaatcttgt
- ASB in cell types
- HCT-116 (colon carcinoma)
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 1.99 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, hip bone mineral density (bmd), hypertension (early onset hypertension), neuroblastoma (brain cancer)
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Colon_Sigmoid, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis