rs889139 chr19:33398463 A>G
- Sequence
agtgggaggccagccctgtacgtg[A/G]agggtgtctgagagactctggccc
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PANC1 (pancreatic ductal adenocarcinoma) | 1.30 | -0.78 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, body mass index (bmi), coronary artery disease (cad), diastolic blood pressure (dbp), fasting insulin, glycated hemoglobin (hba1c), hdl cholesterol, homa-ir, refractive error, systolic blood pressure (sbp), triglycerides, type 2 diabetes
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg