rs889225 chr5:95809018 T>C
- Sequence
gcctggagacaggaagtataaact[T/C]gtgcataaatatagacccattttt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.17 | 0.27 | 1.00 | |||
| macrophages form periferal blood | 0.09 | 1.88 | 2.00 |
Items per page:
1 – 2 of 2