rs889312 chr5:56736057 C>A
- Sequence
tgagatgcccctgctggagaaagg[C/A]atgtgcaaattaagagactacaaa
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- REQU_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REQU_HUMAN | -0.50 | 2.19 | 1.00 | n/a | n/a | |||
| SMRC1_HUMAN | 0.16 | 1.63 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP breast cancer, breast cancer (estrogen receptor negative breast cancer), breast cancer (estrogen receptor positive breast cancer), breast cancer (familial breast cancer), breast cancer (progesterone receptor negative breast cancer), breast cancer (progesterone receptor positive breast cancer), fasting blood glucose, height, serum creatinine, triglycerides
PheWAS abnormal chest sounds, abnormal mammogram, acute and chronic tonsillitis, acute prostatitis, althetes foot, antihypertensive agents causing adverse effects, atrial fibrillation, atrial fibrillation & flutter, bacterial enteritis, barretts esophagus, benign neoplasm of uterus, breast cancer, breast cancer, including in situ, cerebral aneurysm, complication of amputation stump, conductive hearing loss, congenital anomalies of peripheral vascular system, congenital anomalies of urinary system, conjunctivitis, infectious, convulsions, cystic kidney disease, dental caries, dermatophytosis of the body, diffuse diseases of connective tissue, disorders of other cranial nerves, disorders of penis, disturbance of salivary secretion, dysuria, eating disorder, ectropion or entropion, effects of radiation nos, facial nerve disorders, gastrointestinal complications, genital prolapse, glossodynia, hyperosmolality and/or hypernatremia, hypertrophy of female genital organs, idiopathic fibrosing alveolitis, inflammation of eyelids, inflammation of the eye, intestinal infection due to c. difficile, joint effusions, microscopic hematuria, mitral stenosis/insufficiency, myoclonus, nephrotic syndrome without mention of glomerulonephritis, non-healing surgical wound, osteoporosis, osteoporosis, nos or other, other disorders of back, other disorders of eyelids, other disorders of intestine, other disorders of peritoneum, other disorders of the nervous system, other nonspecific findings on examination of urine, other specified intestinal malabsorption, other unspecified back disorders, paroxysmal supraventricular tachycardia, pelvic inflammatory disease, pericarditis, peritoneal adhesions (postoperative) (postinfection), peyronies disease, polyarteritis nodosa and allied conditions, redundant prepuce and phimosis/bxo, sarcoidosis, symptoms and disorders of the joints, symptoms involving head and neck, urethral hypermobility/isd, ventral hernia, viral hepatitis c, wheezing and painful respiration
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood