rs891167 chr19:41883736 A>G
- Sequence
ggccacctaaaaatgaaaaacaac[A/G]ataacaacaacgacgagggtcgct
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma) iPS-derived dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| OCI-LY7 (diffuse large B-cell lymphoma) | 2.56 | -2.18 | 1.00 | |||
| iPS-derived dermal fibroblasts | 1.48 | 1.31 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood