rs892020 chr19:13156371 G>T
- Sequence
gtcacagcaaataacattggtgag[G/T]cctggactaattgattggacaatg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- IRF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IRF4_HUMAN | 2.24 | -2.06 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, arthritis including non-rheumatoid, body mass index (bmi), college completion, longstanding arthritis, rheumatoid arthritis, triglycerides change with statins, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg