rs895760 chr2:46091137 G>T
- Sequence
tgtgtcccctgctggacacggggt[G/T]ggggaagcagggggagggctgggt
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) foreskin keratinocyte thyroid gland K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.62 | -0.71 | 1.00 | |||
| foreskin keratinocyte | -1.94 | 2.89 | 2.00 | |||
| thyroid gland | -1.93 | 2.46 | 1.00 | |||
| K562 (myelogenous leukemia) | 1.19 | -0.30 | 2.00 |
Items per page:
1 – 4 of 4