rs896223 chr2:2704948 T>G
- Sequence
agggtaaacgccctggaggaaggg[T/G]gctttcacaacatggcggtggggg
- ASB in cell types
- TSU-1621-MT (adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TSU-1621-MT (adult acute myeloid leukemia) | 2.33 | -0.23 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, resistance to kuru in aged women despite likely exposure, total cholesterol, total cholesterol change with statins