rs896570 chr10:47145727 C>T
- Sequence
tgagtgacaaagtttccatttcct[C/T]ccccacaaggcagtggtgatgtcc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 1.62 | -1.06 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, body mass index (bmi), hdl cholesterol, height, major depressive disorder, premature ovarian failure, rheumatoid arthritis
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Hypothalamus, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid