rs897811 chr19:11587942 A>C
- Sequence
gggcgtggacagattctacagtgg[A/C]tccagccagagactgccccagaga
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 0.17 | 1.56 | 2.00 | |||
| neutrophils | 2.21 | 0.83 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, homa-b, ldl cholesterol change with statins, maternal transmission distortion, systolic blood pressure (sbp), total cholesterol change with statins
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood