rs900246 chr18:48715760 G>A
- Sequence
ctgggacagtgattatcagcagct[G/A]cttttaaaggcatgcctttggtgt
- ASB in cell types
- CD14+ monocytes monocyte-derived dendritic cells GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.54 | -1.75 | 2.00 | n/a | No Hit | |||
| SPI1_HUMAN | 0.47 | 0.96 | 1.44 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, hip bone mineral density (bmd), neuroblastoma (brain cancer), rheumatoid arthritis, salmonella-induced pyroptosis, triglycerides change with statins