rs900609 chr12:31663833 G>A
- Sequence
cctttccctcattgtgcctaaacc[G/A]cactttatttctcataagctaatt
- ASB in cell types
- MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 1.68 | n/a | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, bipolar disorder, body mass index (bmi), homa-b, homa-ir, hypertension, combined control dataset, rheumatoid arthritis, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio