rs900950 chr3:137032890 G>C
- Sequence
gagattattatggagagtaatgca[G/C]gccgagtgatgcttgctcggcagg
- ASB for transcription factors
- ZN600_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN600_HUMAN | -2.92 | 2.98 | 1.00 | n/a | n/a | |||
| STAG1_HUMAN | 0.14 | 1.27 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), height, ldl cholesterol, obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cortex, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood