rs902331 chr1:237949112 A>T
- Sequence
aataaatgcgtagttaataatttt[A/T]attagtgggtgtgttttgcgggta
- ASB in cell types
- naive endoderm
- ASB for transcription factors
- CDX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDX2_HUMAN | 2.20 | -1.88 | 1.00 | 3.36 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
