rs903115 chr3:8607574 A>C
- Sequence
cctgcccagtttcagaaagaactc[A/C]gtccagtctagacagagaatctcc
- ASB in cell types
- heart left ventricle GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| heart left ventricle | 1.67 | -1.44 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.93 | 1.50 | 1.00 |
Items per page:
1 – 2 of 2