rs904144 chr3:51669494 C>T
- Sequence
cttgcagggatcctgccaagggac[C/T]tcacttggcactgttggaagcagc
- ASB in cell types
- epidermal keratinocytes kidney
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 2.84 | -5.17 | 2.00 | |||
| kidney | 2.51 | -4.74 | 2.00 |
Items per page:
1 – 2 of 2