rs905813 chr5:170604309 G>A
- Sequence
catactggttcatgacatctggtg[G/A]aggtgaggtcagggtgcactggag
- ASB in cell types
- HUES64 (embryonic stem cells) GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | 1.30 | -0.88 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.27 | -0.03 | 1.00 |
Items per page:
1 – 2 of 2