rs907033 chr16:83954251 A>C
- Sequence
tagaggtgccaaagaaacgcagac[A/C]tacaggtgtcccagagtctcagag
- ASB in cell types
- keratinocytes MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma) erythroid progenitors
- ASB for transcription factors
- SNAI2_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | n/a | 3.42 | 1.50 | n/a | No Hit | |||
| CTCF_HUMAN | 0.37 | 1.14 | 1.54 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Hypothalamus, Cells_EBV-transformed_lymphocytes, Liver, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood