rs907576 chr9:97853077 C>T
- Sequence
ccaagcgccctccccgccctgacg[C/T]tgtggggctcctaccgcgccgcca
- ASB in cell types
- WA09 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.54 | -0.51 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Testis, Thyroid, Whole_Blood