rs9083 chr16:57994956 G>A
- Sequence
gcattgtgacagagagccagcacc[G/A]aggggaaggaccagcccctccctg
- ASB in cell types
- neutrophils from periferal blood KMS-11 (Plasma cell myeloma) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.90 | -5.13 | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | -0.26 | 2.09 | 2.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -0.31 | 0.92 | 1.22 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, hdl cholesterol, homa-ir, partial epilepsy, refractive error, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Uterus, Whole_Blood