rs9097 chr7:151081337 G>T
- Sequence
gcccactcccagtgcgggctgagg[G/T]tcagcagccccgggaggtggcccc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
- ASB for transcription factors
- PATZ1_HUMAN ZBT26_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PATZ1_HUMAN | -2.21 | 3.00 | 2.00 | n/a | No Hit | |||
| ZBT26_HUMAN | n/a | 1.64 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood