rs909965 chr6:3157575 C>T
- Sequence
gcccccccagctcggtcttttata[C/T]ccggggacccgccctgcccggtga
- ASB in cell types
- foreskin keratinocyte MS-1 (Small cell lung carcinoma) SUM159PT (Triple negative breast cancer) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.94 | n/a | 2.33 | |||
| MS-1 (Small cell lung carcinoma) | -2.65 | 1.38 | 1.33 | |||
| SUM159PT (Triple negative breast cancer) | 1.35 | 0.76 | 1.11 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.41 | 0.80 | 1.27 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -0.33 | 1.24 | 1.60 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Whole_Blood