rs910077 chr20:1965310 C>A
- Sequence
aaagctcttcctctcagacgttcc[C/A]accttagttgagagctctccacat
- ASB in cell types
- GM02630 (Fanconi anemi) GM12878 (female B-cells lymphoblastoid cell line) GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 2.11 | -1.78 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.63 | 0.24 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -2.00 | 2.09 | 1.33 |
Items per page:
1 – 3 of 3