rs913547 chr20:57481666 A>G
- Sequence
ctgtctatgcaggctcagcaggcc[A/G]cagtgtgcaccacccggctcctgc
- ASB in cell types
- germinal center CD77+ B cells MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| germinal center CD77+ B cells | -4.94 | 2.87 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | 2.17 | 1.22 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, hdl cholesterol, parkinsons disease