rs914327 chr10:12786504 C>G
- Sequence
taatttagaacttttcccccataa[C/G]aaccatagtgttatccaaagcaga
- ASB in cell types
- MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10A (breast epithelial cells) | 2.65 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP lung function, forced expiratory volume in 1 second (fev1) percent predicted (in nonasthmatic participants), parkinsons disease