rs914994 chr1:8857153 G>T
- Sequence
gctgcatctacaggccctagtatg[G/T]aacacattgctaagaagcaggctc
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | -1.72 | 1.91 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diabetic retinopathy in type 2 diabetes mellitus, glaucoma (high pressure glaucoma), glaucoma (primary open-angle glaucoma), salmonella-induced pyroptosis, spine bone mineral density (bmd)
GTEx eQTL Adipose_Subcutaneous, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Thyroid, Whole_Blood