rs915040 chr20:58021626 G>C
- Sequence
ggtcccggagtggcgccccgccgc[G/C]ggtcagtgacttcctccagtgggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | -0.35 | 1.71 | 1.75 | 3.57 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
